View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1503R-Insertion-8 (Length: 261)

Name: NF1503R-Insertion-8
Description: NF1503R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1503R-Insertion-8
NF1503R-Insertion-8
[»] chr6 (1 HSPs)
chr6 (13-261)||(15835568-15835816)
[»] chr5 (2 HSPs)
chr5 (13-255)||(19796330-19796572)
chr5 (13-128)||(19785157-19785272)
[»] chr3 (1 HSPs)
chr3 (53-260)||(47713422-47713629)


Alignment Details
Target: chr6 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 13 - 261
Target Start/End: Original strand, 15835568 - 15835816
Alignment:
Q  13 ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15835568 ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa 15835667  T
Q  113 acattggtagctagggttttagggtgattttcatgcaaccagagagcagcagcgtagaagccttctttattggacttgccggtaccacgaacaccacgga 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15835668 acattggtagctagggttttagggtgattttcatgcaaccagagagcagcagcgtagaagccttctttattggacttgccggtaccacgaacaccacgga 15835767  T
Q  213 ggttacagacgagtttgggggtggtgagtgggttatgggaccatgctag 261  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||    
T  15835768 ggttacagacgagtttgagggtggtgagtgggttatgggaccatgctag 15835816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 13 - 255
Target Start/End: Original strand, 19796330 - 19796572
Alignment:
Q  13 ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa 112  Q
    |||||||||||||||  ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||  |||| |    
T  19796330 ccactcttctttctgtgttttgcgaacttcagaaccttcgagaagacggtagaggatctcagggagatctttgaagtagccaaagtcagcgagagaagga 19796429  T
Q  113 acattggtagctagggttttagggtgattttcatgcaaccagagagcagcagcgtagaagccttctttattggacttgccggtaccacgaacaccacgga 212  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||| || ||||||||||||||||| |||||||| |||||||| || || |||||||    
T  19796430 acattggtagctagggttttagggtgattttcatgaaaccagagagcggcggcgtagaagccttctttgttggactttccggtaccgcggacgccacgga 19796529  T
Q  213 ggttacagacgagtttgggggtggtgagtgggttatgggacca 255  Q
    ||||||||||||||||| ||| |||||| ||||| ||||||||    
T  19796530 ggttacagacgagtttgagggcggtgagagggttttgggacca 19796572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 128
Target Start/End: Complemental strand, 19785272 - 19785157
Alignment:
Q  13 ccactcttctttctgcttttcgcgaacttcaaaaccttcgagaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaa 112  Q
    |||||||||||||||  |||| |||| | || |||||| ||||| |||||| || || ||||||||||||||||||||||||||| |||| | || || |    
T  19785272 ccactcttctttctggatttcacgaattccagaaccttggagaatacggtatagaatttcagggagatctttgaagtaaccaaagtcagcaagtgtagga 19785173  T
Q  113 acattggtagctaggg 128  Q
    |||||||||| |||||    
T  19785172 acattggtagttaggg 19785157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 53 - 260
Target Start/End: Original strand, 47713422 - 47713629
Alignment:
Q  53 agaagacggtagaggatctcagggagatctttgaagtaaccaaaggcagcgaatgaagaaacattggtagctagggttttagggtgattttcatgcaacc 152  Q
    ||||||||||| ||||| || |||||||||||||||||||||||| |||| |  ||||  || || | |||||||||||||||||| |  |  || ||||    
T  47713422 agaagacggtaaaggatttctgggagatctttgaagtaaccaaagtcagcaagggaagggacgttagaagctagggttttagggtggtagtggtgaaacc 47713521  T
Q  153 agagagcagcagcgtagaagccttctttattggacttgccggtaccacgaacaccacggaggttacagacgagtttgggggtggtgagtgggttatggga 252  Q
    | |||||||| |||||||| |||||   || ||||||||||||||| ||||| || ||||||||||||||||||||  |||||||||||||||||| |||    
T  47713522 aaagagcagcggcgtagaaaccttcacgatcggacttgccggtaccgcgaacgccgcggaggttacagacgagtttaagggtggtgagtgggttatagga 47713621  T
Q  253 ccatgcta 260  Q
    ||||||||    
T  47713622 ccatgcta 47713629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University