View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1503R-Insertion-1 (Length: 40)

Name: NF1503R-Insertion-1
Description: NF1503R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1503R-Insertion-1
NF1503R-Insertion-1
[»] chr4 (1 HSPs)
chr4 (5-40)||(41108101-41108136)
[»] chr7 (1 HSPs)
chr7 (5-37)||(35702510-35702542)


Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.000000000002
Query Start/End: Original strand, 5 - 40
Target Start/End: Original strand, 41108101 - 41108136
Alignment:
Q  5 atcatctcagccattaatcacgctctgatcgcatgg 40  Q
    ||||||||||||||||||||||||||||||||||||    
T  41108101 atcatctcagccattaatcacgctctgatcgcatgg 41108136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Complemental strand, 35702542 - 35702510
Alignment:
Q  5 atcatctcagccattaatcacgctctgatcgca 37  Q
    |||||||||||| ||||||||||||||||||||    
T  35702542 atcatctcagccgttaatcacgctctgatcgca 35702510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University