View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15036_low_45 (Length: 255)

Name: NF15036_low_45
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15036_low_45
NF15036_low_45
[»] chr6 (1 HSPs)
chr6 (18-162)||(32343297-32343441)


Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 18 - 162
Target Start/End: Complemental strand, 32343441 - 32343297
Alignment:
Q  18 gtttaggtggtggttatggaggaggtggaatatctaagggaattgtaggtggaattggaggttatggaggtggaacatctaagggaattggaggtggaat 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  32343441 gtttaggtggtggttatggaggaggtggaatatctaagggaattgttggtggaattggaggttatggaggtggaatatctaagggaattggaggtggaat 32343342  T
Q  118 tggaggttttgcttacaaaggaattggaggaggtgtaggagggat 162  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
T  32343341 tggaggttttgcttacaaaggaattggaggaggtgtaggagggat 32343297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University