View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15036_low_29 (Length: 315)

Name: NF15036_low_29
Description: NF15036
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15036_low_29
NF15036_low_29
[»] chr5 (2 HSPs)
chr5 (174-297)||(29280253-29280376)
chr5 (17-58)||(29280492-29280533)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 174 - 297
Target Start/End: Complemental strand, 29280376 - 29280253
Alignment:
Q  174 ggttgttcctatactcaatcaaaaagaataaaagtaaccaaattagtaccatggtccaagaacttatgttgactcactaatggccattttacaactgtcg 273  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  29280376 ggttgttcctatactcaatcaaaaagaataaaagtaaacaaattagtaccatggtccaagaacttatgttgactcactaatgaccattttacaactgtcg 29280277  T
Q  274 tcaaagaattttgaaccattgttt 297  Q
    | ||||||||||||||||||||||    
T  29280276 ttaaagaattttgaaccattgttt 29280253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 29280533 - 29280492
Alignment:
Q  17 atgcaaatccacaaaaagcacacatggttctggtggtttagg 58  Q
    |||||||||||||||||| |||||||||||||||||||||||    
T  29280533 atgcaaatccacaaaaagtacacatggttctggtggtttagg 29280492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University