View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15035_low_16 (Length: 221)

Name: NF15035_low_16
Description: NF15035
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15035_low_16
NF15035_low_16
[»] chr4 (1 HSPs)
chr4 (19-211)||(51652817-51653009)
[»] chr2 (1 HSPs)
chr2 (20-198)||(19152739-19152917)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 19 - 211
Target Start/End: Original strand, 51652817 - 51653009
Alignment:
Q  19 gtaccgtgtgatttgtgacaccaagggagctttcgtgcaacctgctgtgtatgaagctttcggtttgacagttgttgaggccatggctactggattgcca 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  51652817 gtaccgtgtgatttgtgacaccaagggagctttcgtgcaacctgctgtgtatgaagctttcggtttgacagttgttgaggccatggctactggattacca 51652916  T
Q  119 acatttgcaactcttaatggtggccctgctgagatcattgtccatggcaaatctggattccacattgatccttaccatggcgtctgtgctgct 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||    
T  51652917 acatttgcaactcttaatggtggccctgctgagatcattgtccatggcaaatctggattccacattgatccttaccatggcgaccgtgctgct 51653009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 20 - 198
Target Start/End: Complemental strand, 19152917 - 19152739
Alignment:
Q  20 taccgtgtgatttgtgacaccaagggagctttcgtgcaacctgctgtgtatgaagctttcggtttgacagttgttgaggccatggctactggattgccaa 119  Q
    |||||||| ||||| ||||| ||||||||||| ||||| |||||| | ||||||||||| |||||||| |||||||| || ||| ||  ||||||||| |    
T  19152917 taccgtgtcatttgcgacacaaagggagcttttgtgcagcctgctatttatgaagcttttggtttgactgttgttgaagctatgacttgtggattgccga 19152818  T
Q  120 catttgcaactcttaatggtggccctgctgagatcattgtccatggcaaatctggattccacattgatccttaccatgg 198  Q
    |||| |||||   ||||||||| ||||||||||||||||| ||||| |||||||| | ||| ||||||||||| |||||    
T  19152817 cattcgcaacgtgtaatggtggtcctgctgagatcattgttcatggaaaatctggttaccatattgatccttatcatgg 19152739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University