View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15034_low_12 (Length: 257)

Name: NF15034_low_12
Description: NF15034
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15034_low_12
NF15034_low_12
[»] chr3 (2 HSPs)
chr3 (34-196)||(54150913-54151075)
chr3 (188-233)||(54151122-54151167)


Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 34 - 196
Target Start/End: Original strand, 54150913 - 54151075
Alignment:
Q  34 aatactcaagtaatgaatgctatattagctatggtaagatattctctgattttcttctactattcatctgtgattttatcattccactcttgtttatgat 133  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54150913 aatactcaagtaatgaatgatatattagctatggtaagatattctctaattttcttctactattcatctgtgattttatcattccactcttgtttatgat 54151012  T
Q  134 ttttattttctactttcagattgctgaggatcatgctggaaagcaaattgatcgaaaattgat 196  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54151013 ttttattttctactttcagattgctgaggatcatgctggaaagcaaattgatcgaaaattgat 54151075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 233
Target Start/End: Original strand, 54151122 - 54151167
Alignment:
Q  188 aaaattgataaaaaatacgttgattgaaagagaatgtaacattata 233  Q
    |||||||||  |||||||||||||||||||||||||||||||||||    
T  54151122 aaaattgatccaaaatacgttgattgaaagagaatgtaacattata 54151167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University