View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15027_high_2 (Length: 272)

Name: NF15027_high_2
Description: NF15027
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15027_high_2
NF15027_high_2
[»] chr3 (1 HSPs)
chr3 (4-165)||(45386947-45387108)


Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 4 - 165
Target Start/End: Complemental strand, 45387108 - 45386947
Alignment:
Q  4 tagcatatcatagagtactactatagaggtgtactttagcagtagtatacaaaagcgagagagaaggcaaagacggcataagtgatagttgcacgaagct 103  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45387108 tagcatatcatagagtagtactatagaggtgtactttagcagtagtatacaaaagcgagagagaaggcaaagacggcataagtgatagttgcacgaagct 45387009  T
Q  104 tatcttagaggcagattccttttgtgaaacttgaagccatgggagaggtttttaatgataac 165  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  45387008 tatcttagaggcagattccttttgtgaaacttgaagccatgggagaggtttctaatgataac 45386947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University