View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15026_low_25 (Length: 264)

Name: NF15026_low_25
Description: NF15026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15026_low_25
NF15026_low_25
[»] chr7 (2 HSPs)
chr7 (133-245)||(40758150-40758262)
chr7 (14-81)||(40758314-40758381)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 133 - 245
Target Start/End: Complemental strand, 40758262 - 40758150
Alignment:
Q  133 ggcagtggtttgatcatttatctcatgtctgatgtctctctgattcatattgtattcatgatggtggctgatcattcatatagcagtgtgcctacaagaa 232  Q
    |||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||    
T  40758262 ggcagtggtttgatcattcatctcatgtctgatgtctctatgattcatattatattcatgatggtggctgatcattcatattgcagtgtgcctacaagaa 40758163  T
Q  233 gagacaacgtgat 245  Q
    |||||||||||||    
T  40758162 gagacaacgtgat 40758150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 81
Target Start/End: Complemental strand, 40758381 - 40758314
Alignment:
Q  14 attattctttcggtataaataacatcagcataacagttctttcaacatcaataatatcacaatgctta 81  Q
    ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
T  40758381 attattctttcagtataaataacatcagcataacaattctttcaacatcaataatatcacaatgctta 40758314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University