View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15025_low_57 (Length: 239)

Name: NF15025_low_57
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15025_low_57
NF15025_low_57
[»] chr3 (2 HSPs)
chr3 (107-223)||(44889554-44889670)
chr3 (1-37)||(44889741-44889777)
[»] chr7 (1 HSPs)
chr7 (109-143)||(35143509-35143543)


Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 107 - 223
Target Start/End: Complemental strand, 44889670 - 44889554
Alignment:
Q  107 ggttgctgacatcaaattataaaaacagttttgcagatcttctagtagccaaaaagcaaaagtaaccacaaatggaattagtaagaactgcaagattata 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44889670 ggttgctgacatcaaattataaaaacagttttgcagatcttctagtagccaaaaagcaaaagtaaccacaaatggaattagtaagaactgcaagattata 44889571  T
Q  207 cgatgcaggtagcgatt 223  Q
     |||| |||||||||||    
T  44889570 tgatggaggtagcgatt 44889554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 44889777 - 44889741
Alignment:
Q  1 ataaaacgaagaattcgtgaatttatatcttaacttt 37  Q
    |||||||||||||||||||||||||||||||||||||    
T  44889777 ataaaacgaagaattcgtgaatttatatcttaacttt 44889741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 109 - 143
Target Start/End: Complemental strand, 35143543 - 35143509
Alignment:
Q  109 ttgctgacatcaaattataaaaacagttttgcaga 143  Q
    ||||||||| |||||||||||||||||||||||||    
T  35143543 ttgctgacagcaaattataaaaacagttttgcaga 35143509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University