View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15025_high_61 (Length: 228)

Name: NF15025_high_61
Description: NF15025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15025_high_61
NF15025_high_61
[»] chr4 (1 HSPs)
chr4 (1-136)||(6089230-6089362)


Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 6089362 - 6089230
Alignment:
Q  1 tggatctatgatttatggtggtggaggtgtgattcaagggttggttgaaggaggaggaggaagtggtggttcagttccatttactggatatgcttctgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||   |||||||||||||||||||||||||||||||||||||||    
T  6089362 tggatctatgatttatggtggtggaggtgtgattcaaggtttggttgaaggaggagga---agtggtggttcagttccatttactggatatgcttctgtt 6089266  T
Q  101 ttgaaggattctaggtttttgaaaccagctcaagaa 136  Q
    ||||||||||||||||||||||||||||||||||||    
T  6089265 ttgaaggattctaggtttttgaaaccagctcaagaa 6089230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University