View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15023_low_16 (Length: 319)

Name: NF15023_low_16
Description: NF15023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15023_low_16
NF15023_low_16
[»] chr6 (1 HSPs)
chr6 (24-59)||(23118931-23118966)


Alignment Details
Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 24 - 59
Target Start/End: Original strand, 23118931 - 23118966
Alignment:
Q  24 ccggagggtgatctggaggagtattaaattgctcaa 59  Q
    |||||| |||||||||||||||||||||||||||||    
T  23118931 ccggagagtgatctggaggagtattaaattgctcaa 23118966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University