View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15022_high_22 (Length: 236)

Name: NF15022_high_22
Description: NF15022
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15022_high_22
NF15022_high_22
[»] chr3 (1 HSPs)
chr3 (1-221)||(37629187-37629407)


Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 37629187 - 37629407
Alignment:
Q  1 ttaaggtcctgagtttgagtcttgtgaacggnnnnnnnnntgtggatgagtgtttcacatgtatgatctgttaacnnnnnnnnntgatgattacaattta 100  Q
    |||||||| ||||||||||||||||||||||         |||||||||||||||||||| ||||||||||||||         ||||||||||||||||    
T  37629187 ttaaggtcttgagtttgagtcttgtgaacggaaaaaaaaatgtggatgagtgtttcacatctatgatctgttaacaaaaaaaaatgatgattacaattta 37629286  T
Q  101 ttgagattctaaattattcaagacaatgatgcaggaaatcaatgaaggaatttgctttgaagctagagacacttgcagaggagctactagacttattatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37629287 ttgagattctaaattattcaagacaatgatgcaggaaatcaatgaaggaatttgctttgaagctagagacacttgcagaggagctactagacttattatg 37629386  T
Q  201 tgaaaatcttggactagaaaa 221  Q
    |||||||||||||||||||||    
T  37629387 tgaaaatcttggactagaaaa 37629407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University