View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15017_high_7 (Length: 219)

Name: NF15017_high_7
Description: NF15017
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15017_high_7
NF15017_high_7
[»] chr4 (1 HSPs)
chr4 (1-203)||(23890431-23890633)
[»] chr8 (2 HSPs)
chr8 (1-163)||(27986309-27986474)
chr8 (1-163)||(28043611-28043776)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 23890431 - 23890633
Alignment:
Q  1 taccagtttccaactgattattctaccaagaggttccagaaaaccgataaacggaggaagttgtcaagaccgaagtcagtggcttcggttcttcatcggt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
T  23890431 taccagtttccaactgattattctaccaagaggttccagaaaaccgataaccggaggaagttgtcaagatcgaagtcagtggcttcggttcttcatcggt 23890530  T
Q  101 taacgatggaagatcgacaaggccgaacgccgccgtgacttccgacgtcgtcagttgttttggttggaaggataacggcgggttcggcggttggtggtgg 200  Q
    |||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23890531 taacgatggaagatcgacgacgccgaacgccgccgtgacttccgacgtcgtcagttgttttggttggaaggataacggcgggttcggcggttggtggtgg 23890630  T
Q  201 ttt 203  Q
    |||    
T  23890631 ttt 23890633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 27986309 - 27986474
Alignment:
Q  1 taccagtttccaactgattattctaccaagaggttccagaaaaccgataaacggaggaagttgtcaagaccgaagtcagtggcttcggttcttcatcggt 100  Q
    |||||||||||||||||||| || |||||||||||||||||||| ||| | |||||||||| || |||| |||| ||||||||||| |||||||||||||    
T  27986309 taccagtttccaactgattactccaccaagaggttccagaaaactgatcaccggaggaagtagttaagatcgaactcagtggcttctgttcttcatcggt 27986408  T
Q  101 taacgatggaaga---tcgacaaggccgaacgccgccgtgacttccgacgtcgtcagttgttttgg 163  Q
    |||||||||||||   |||| || ||||||||||||||| ||||||||||| | |||| |||||||    
T  27986409 taacgatggaagatcgtcgataacgccgaacgccgccgtaacttccgacgtagacagtggttttgg 27986474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 1 - 163
Target Start/End: Original strand, 28043611 - 28043776
Alignment:
Q  1 taccagtttccaactgattattctaccaagaggttccagaaaaccgataaacggaggaagttgtcaagaccgaagtcagtggcttcggttcttcatcggt 100  Q
    |||||||||||||||||||| || |||||||||||||||||||| ||| | |||||||||| || |||| |||| ||||||||||| |||||||||||||    
T  28043611 taccagtttccaactgattactccaccaagaggttccagaaaactgatcaccggaggaagtagttaagatcgaactcagtggcttctgttcttcatcggt 28043710  T
Q  101 taacgatggaaga---tcgacaaggccgaacgccgccgtgacttccgacgtcgtcagttgttttgg 163  Q
    |||||||||||||   |||| || ||||||||||||||| ||||||||||| | |||| |||||||    
T  28043711 taacgatggaagatcgtcgataacgccgaacgccgccgtaacttccgacgtagacagtggttttgg 28043776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University