View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1500_low_48 (Length: 260)

Name: NF1500_low_48
Description: NF1500
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1500_low_48
NF1500_low_48
[»] chr4 (1 HSPs)
chr4 (158-196)||(21268547-21268585)


Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 158 - 196
Target Start/End: Complemental strand, 21268585 - 21268547
Alignment:
Q  158 ttatttccaccatttccacccttatttttcttcttctgt 196  Q
    ||||| |||||||||||||||||||||||||||||||||    
T  21268585 ttattcccaccatttccacccttatttttcttcttctgt 21268547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University