View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15007_low_21 (Length: 212)

Name: NF15007_low_21
Description: NF15007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15007_low_21
NF15007_low_21
[»] chr1 (1 HSPs)
chr1 (89-198)||(6451364-6451473)


Alignment Details
Target: chr1 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 89 - 198
Target Start/End: Original strand, 6451364 - 6451473
Alignment:
Q  89 attaaataacatctctgcgtctgcatcatgtggctctgtgacatggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt 188  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6451364 attaaataacatctctgcgtctgcatcatgtggctctgtgacctggttggtgtcaccgaacatcacaggctacacttatggtcatatattccttcccctt 6451463  T
Q  189 aattttcttc 198  Q
    ||||||||||    
T  6451464 aattttcttc 6451473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University