View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15004_low_3 (Length: 514)

Name: NF15004_low_3
Description: NF15004
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15004_low_3
NF15004_low_3
[»] chr6 (2 HSPs)
chr6 (72-225)||(15595814-15595967)
chr6 (457-503)||(14734743-14734789)


Alignment Details
Target: chr6 (Bit Score: 66; Significance: 6e-29; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 72 - 225
Target Start/End: Complemental strand, 15595967 - 15595814
Alignment:
Q  72 tttctgagcaacttcgactcttaggatatatcataaccgataggtctctgcttaggttcaaaacaatttgtagagaggttcaacaacaaaggacacataa 171  Q
    |||||||||||||||||| |||||||||||||||||||||||| |  || ||||||||||||| || ||||| |    |  | || ||||||||||||||    
T  15595967 tttctgagcaacttcgacccttaggatatatcataaccgatagattactccttaggttcaaaataacttgtacatgaatgtaccatcaaaggacacataa 15595868  T
Q  172 aatcttgctacttaaattttgcttaacgtcatcatattaccgatatttatcata 225  Q
    |  |||||||||||||||||||||||| ||||||||||  ||||| ||||||||    
T  15595867 acccttgctacttaaattttgcttaacatcatcatattggcgatacttatcata 15595814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 457 - 503
Target Start/End: Complemental strand, 14734789 - 14734743
Alignment:
Q  457 ccgattccatccctctttaccttgaaaacacattcgaaaataccttt 503  Q
    ||||||||||| ||||| |||||||||||||||||||||||||||||    
T  14734789 ccgattccatctctcttgaccttgaaaacacattcgaaaataccttt 14734743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University