View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1499_high_50 (Length: 249)

Name: NF1499_high_50
Description: NF1499
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1499_high_50
NF1499_high_50
[»] chr3 (1 HSPs)
chr3 (167-205)||(4703060-4703098)


Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 167 - 205
Target Start/End: Original strand, 4703060 - 4703098
Alignment:
Q  167 tgaacatttcagcacagtatagctaacttgtctcctact 205  Q
    ||||||||||||||||||||||||||||| |||||||||    
T  4703060 tgaacatttcagcacagtatagctaacttctctcctact 4703098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University