View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14999_low_20 (Length: 276)

Name: NF14999_low_20
Description: NF14999
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14999_low_20
NF14999_low_20
[»] chr8 (3 HSPs)
chr8 (18-166)||(3960621-3960762)
chr8 (78-164)||(3960230-3960316)
chr8 (154-196)||(3960562-3960604)


Alignment Details
Target: chr8 (Bit Score: 71; Significance: 3e-32; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 166
Target Start/End: Complemental strand, 3960762 - 3960621
Alignment:
Q  18 agtggatttggaatccgaaggattgccttttgaggtaataggggttgctgtctgggccctggggtctgccgtgatttggttttaggactgtttcattagt 117  Q
    ||||||| ||||||| |||||||||||||||||||||||||| || || |||||||       || | || ||||| |||||| ||||| ||||||||||    
T  3960762 agtggatgtggaatctgaaggattgccttttgaggtaataggagtcgcggtctggg-------gttttccttgattcggttttgggactatttcattagt 3960670  T
Q  118 ccgttgggagctctgcaagcggtttgggtttttgccttgctgctgtctt 166  Q
    |||||||||||||||||||||||| ||||||||||||||||||| ||||    
T  3960669 ccgttgggagctctgcaagcggttcgggtttttgccttgctgctatctt 3960621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 78 - 164
Target Start/End: Complemental strand, 3960316 - 3960230
Alignment:
Q  78 ggggtctgccgtgatttggttttaggactgtttcattagtccgttgggagctctgcaagcggtttgggtttttgccttgctgctgtc 164  Q
    ||||| || ||||||| |||||| ||||||||||||||||| |||||||||||||| ||||| | |||||| |||||||||||||||    
T  3960316 ggggtttgacgtgattcggttttgggactgtttcattagtcagttgggagctctgccagcggctcgggtttctgccttgctgctgtc 3960230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 3960604 - 3960562
Alignment:
Q  154 ttgctgctgtcttagtttgcgcagagctgagcgcgttttttcc 196  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  3960604 ttgctgctgtcttagtttgcgcagagctgagcgcgttttttcc 3960562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University