View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14997_high_7 (Length: 237)

Name: NF14997_high_7
Description: NF14997
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14997_high_7
NF14997_high_7
[»] chr7 (1 HSPs)
chr7 (9-223)||(40405510-40405729)
[»] chr1 (1 HSPs)
chr1 (13-97)||(29026345-29026429)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 9 - 223
Target Start/End: Complemental strand, 40405729 - 40405510
Alignment:
Q  9 acctgtggagaaaaatgagtactttgttcttgatgaggaggaagaggaagcagctcaaattgctctcagagatgaagaatttgagctttaaagtttctgt 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40405729 acctgtggagaaaaatgagtactttgttcttgatgaggaggaagaggaagcagctcaaattgctctcagagatgaagaatttgagctttaaagtttctgt 40405630  T
Q  109 ttttggaattttgcacttacccctatgtgttgatatctccgccacg-----ccacaaagatcaggcaggttgttcgatgaattcggtattgtgctggtgg 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||| ||||||||||||||||    
T  40405629 ttttggaattttgcacttacccctatgtgttgatatctccgccacgccacgccacaaagatcaggcaggttgttcgatgaatttggtattgtgctggtgg 40405530  T
Q  204 tggttcaggttgctcctttt 223  Q
    ||||||||||||||||||||    
T  40405529 tggttcaggttgctcctttt 40405510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 29026429 - 29026345
Alignment:
Q  13 gtggagaaaaatgagtactttgttcttgatgaggaggaagaggaagcagctcaaattgctctcagagatgaagaatttgagcttt 97  Q
    |||||||| |||||||| ||||| |||||||||||||| || ||||| ||  |  |||||||||| || ||||| ||||||||||    
T  29026429 gtggagaagaatgagtattttgtgcttgatgaggaggaggaagaagctgcggaggttgctctcagggaagaagagtttgagcttt 29026345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University