View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14996_low_11 (Length: 205)

Name: NF14996_low_11
Description: NF14996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14996_low_11
NF14996_low_11
[»] chr1 (1 HSPs)
chr1 (26-142)||(29638080-29638196)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 26 - 142
Target Start/End: Complemental strand, 29638196 - 29638080
Alignment:
Q  26 atatatagcccatcccaccaacaaaagaagaatgtcatcgactggtaggcaacgtattccttttgagttttgctttgtgtcgtaataaataaataaacta 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||    
T  29638196 atatatagcccatcccaccaacaaaagaagaatgtcatcgactggtaggcaacgtattccttttgagttttgccttttgtcgtaataaataaataaacta 29638097  T
Q  126 tacacaacattattgtt 142  Q
    |||||||||||||||||    
T  29638096 tacacaacattattgtt 29638080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University