View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14994_low_21 (Length: 212)

Name: NF14994_low_21
Description: NF14994
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14994_low_21
NF14994_low_21
[»] chr2 (1 HSPs)
chr2 (64-155)||(20700314-20700405)
[»] chr4 (1 HSPs)
chr4 (160-195)||(46300676-46300711)


Alignment Details
Target: chr2 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 64 - 155
Target Start/End: Original strand, 20700314 - 20700405
Alignment:
Q  64 gatttcacgtcaagaaaggagaggacttcggcgatgagatcatccggaagggtcactggcgaaggagggttgatttcacgccgagacttaga 155  Q
    |||||||||||||||||||  |||||||| ||||||||||||||||| ||| | || |||||||||| |||||||||| ||||| |||||||    
T  20700314 gatttcacgtcaagaaaggccaggacttccgcgatgagatcatccgggaggattaccggcgaaggagagttgatttcatgccgaaacttaga 20700405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 160 - 195
Target Start/End: Complemental strand, 46300711 - 46300676
Alignment:
Q  160 ctgtgtgccgccgtggagttgatgattacttgatat 195  Q
    ||||||||||||||||||||||||||||||||||||    
T  46300711 ctgtgtgccgccgtggagttgatgattacttgatat 46300676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University