View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_low_227 (Length: 251)

Name: NF1498_low_227
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_low_227
NF1498_low_227
[»] chr3 (2 HSPs)
chr3 (171-251)||(20709796-20709876)
chr3 (16-92)||(20709641-20709717)


Alignment Details
Target: chr3 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 171 - 251
Target Start/End: Original strand, 20709796 - 20709876
Alignment:
Q  171 gcaataggtatccaagtacgttgaatgttagctatcgtacacatgaagaactcaattacaattaaggtttttctttggctt 251  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20709796 gcaataggtatccaagtacgttgaatgttagctatcgtacacatgaagaactcaattacaattaaggtttttctttggctt 20709876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 16 - 92
Target Start/End: Original strand, 20709641 - 20709717
Alignment:
Q  16 atttcaaattagaaacataattctttagtcaacgtgattctaactttaatctttaaagtaatttatttaaatagtta 92  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20709641 atttcaaattagaaacatgattctttagtcaacgtgattctaactttaatctttaaagtaatttatttaaatagtta 20709717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University