View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_low_223 (Length: 252)

Name: NF1498_low_223
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_low_223
NF1498_low_223
[»] chr2 (1 HSPs)
chr2 (1-234)||(37562384-37562617)


Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 37562617 - 37562384
Alignment:
Q  1 tgcgcttaatatgagtaaaggcttgtcatttttgtctacttttttgctcttcctcacctcgcaacagcataacaacaagcctattaagattataattcct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  37562617 tgcgcttaatatgagtaaaggcttgtcatttttgtctacttttttgctcttcctcacctcgcgacagcataacaacaagcctattaagattataattcct 37562518  T
Q  101 gatgcagttacagcaacaataattgctttccgttgtttgtcatcatgcgttgaatcaaaagtagaatgaggaggaggtggtggtggcggtggtgcaaata 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37562517 gatgcagttacagcaacaataattgctttccgttgtttgtcatcatgcgttgaatcaaaagtagaatgaggaggaggtggtggtggcggtggtgcaaata 37562418  T
Q  201 gaaaccaaaaatcgtcatatgagtgctcgggagt 234  Q
    |||||||||||||||||||||||||||| |||||    
T  37562417 gaaaccaaaaatcgtcatatgagtgctcaggagt 37562384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University