View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_low_139 (Length: 335)

Name: NF1498_low_139
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_low_139
NF1498_low_139
[»] chr5 (1 HSPs)
chr5 (89-320)||(15630928-15631160)


Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 89 - 320
Target Start/End: Complemental strand, 15631160 - 15630928
Alignment:
Q  89 atgagggagatgcgaa-gtcgtgatcaagggtgggaaaagtccttggtggcttggagatgaataccctaacgagcacttgatattatcaaactagttacg 187  Q
    ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  15631160 atgagggagatgccaaagtcgtgatcaagggtgggaaaagtccttggtggcttggagatgaataccctaacgagcacttgatattatcaaattagttacg 15631061  T
Q  188 tgtgcaatctatggcattcaccaaaatgagcgatactttactttgcgagatgcaaagcatgtattattggtcaagcgttccttattgagttcagtaccgc 287  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15631060 tgtgcaatctatggcattcaccaaaatgagcgatactttactctgcgagatgcaaagcatgtattattggtcaagcgttccttattgagttcagtaccgc 15630961  T
Q  288 atgcaattgatgaaatagagtagagtatctgtg 320  Q
    ||||||||||| || ||||||||||||| ||||    
T  15630960 atgcaattgataaagtagagtagagtatgtgtg 15630928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University