View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_high_279 (Length: 222)

Name: NF1498_high_279
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_high_279
NF1498_high_279
[»] chr8 (1 HSPs)
chr8 (61-204)||(9937564-9937701)


Alignment Details
Target: chr8 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 61 - 204
Target Start/End: Original strand, 9937564 - 9937701
Alignment:
Q  61 agaagttaagtttgccttctcatgtgacatttagccacaactagcatcacaaacttcgtttccaaacaacttgccccaaaattcaaattcaaataaaatt 160  Q
    ||||||||| |||||||| | ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||      |||||||| |||||||    
T  9937564 agaagttaaatttgccttattatgtgacatttagccacaactagcatcacaaacttagtttccaaacaacttgcccca------aaattcaattaaaatt 9937657  T
Q  161 gttgtacaaagaaaacattcatgatttagtaagatgggacaatt 204  Q
    |||||||||||||||||||||||||||||||||||| |||||||    
T  9937658 gttgtacaaagaaaacattcatgatttagtaagatgagacaatt 9937701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University