View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1498_high_149 (Length: 313)

Name: NF1498_high_149
Description: NF1498
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1498_high_149
NF1498_high_149
[»] chr2 (2 HSPs)
chr2 (82-295)||(7790350-7790563)
chr2 (17-53)||(7790592-7790628)


Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 82 - 295
Target Start/End: Complemental strand, 7790563 - 7790350
Alignment:
Q  82 tttgtccctggtgtttaacacaggatggaatgggatgggaaatgagcatggaggatgtgtttggttatatagagtgaaaacaagagggtactttggccat 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7790563 tttgtccctggtgtttaacacaggatggaatgggatgggaaatgagcatggaggatgtgtttggttatatagagtgaaaacaagagggtactttggccat 7790464  T
Q  182 ttcatattttatattaaaatattggtgtatctataattccgtcactgtttgtgattaattgacaggttaattaaaatagtggcatgggaccaaagaaaag 281  Q
    ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7790463 ttcatattttatattaaaatattggtccatctataattccgtcactgtttgtgattaattgacaggttaattaaaatagtggcatgggaccaaagaaaag 7790364  T
Q  282 aggatggcttatag 295  Q
    ||||||||||||||    
T  7790363 aggatggcttatag 7790350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 17 - 53
Target Start/End: Complemental strand, 7790628 - 7790592
Alignment:
Q  17 gagctactgaatatccccaacatattttttctctctc 53  Q
    |||||||||||||||||||||||||||||||||||||    
T  7790628 gagctactgaatatccccaacatattttttctctctc 7790592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University