View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14988_low_5 (Length: 304)

Name: NF14988_low_5
Description: NF14988
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14988_low_5
NF14988_low_5
[»] chr8 (1 HSPs)
chr8 (17-253)||(32906591-32906827)


Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 17 - 253
Target Start/End: Original strand, 32906591 - 32906827
Alignment:
Q  17 atcacttttgttggcgagtttagaaatagattgggaaatttactacggttgattgtatgttaaatttggattactttggatttggaacattagatttgga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||     
T  32906591 atcacttttgttggcgagtttagaaatagattgggaaatttactaaggttgattgtatgttaaatttggattactttggatttggaacattagatttggt 32906690  T
Q  117 tttacgctgttttcccctcgacaataactttacttgcaacgctgcatcataattagtgaaaaatacccaaattcactttcttgcttgagttttaatcaat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32906691 tttacgctgttttcccctcgacaataactttacttgcaacgctgcatcataattagtgaaaaatacccaaattcactttcttgcttgagttttaatcaat 32906790  T
Q  217 gcaatgtttctcaatctttttcgaaatattgcttata 253  Q
    |||||||||||||||||||||||||||||||||||||    
T  32906791 gcaatgtttctcaatctttttcgaaatattgcttata 32906827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University