View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14986_high_25 (Length: 256)

Name: NF14986_high_25
Description: NF14986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14986_high_25
NF14986_high_25
[»] chr5 (2 HSPs)
chr5 (75-151)||(28143702-28143778)
chr5 (11-45)||(28143643-28143677)


Alignment Details
Target: chr5 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 75 - 151
Target Start/End: Original strand, 28143702 - 28143778
Alignment:
Q  75 tggattcggaatgggaaactcttcatacaatcttaaccaaatcactcaccatcctttcctggtataccaacacttct 151  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28143702 tggattcggaatgggaaactcttcatacaatcttaaccaaatcactcaccatcctttcctggtataccaacacttct 28143778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 45
Target Start/End: Original strand, 28143643 - 28143677
Alignment:
Q  11 gagtgagaagaaaagaataagaacttagattgaag 45  Q
    |||||| ||||||||||||||||||||||||||||    
T  28143643 gagtgaaaagaaaagaataagaacttagattgaag 28143677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University