View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14984_low_33 (Length: 215)

Name: NF14984_low_33
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14984_low_33
NF14984_low_33
[»] chr4 (2 HSPs)
chr4 (1-180)||(2530452-2530631)
chr4 (3-50)||(23896741-23896789)


Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 2530452 - 2530631
Alignment:
Q  1 caatccgtacatgcagatggtgtatgcatgtgagttattttttcccttgtgtttttaattctatccttttagatacttatgaatttacaaaccataatgg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2530452 caatccgtacatgcagatggtgtatgcatgtgagttattttttcccttgtgtttttaattctatccttttagatacttatgaatttacaaaccataatgg 2530551  T
Q  101 aatatcattacttccaaaatatgtatcttttttgtttattattcttgtaggtactagttgatgccaaatgttatctctct 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2530552 aatatcattacttccaaaatatgtatcttttttgtttattattcttgtaggtactagttgatgccaaatgttatctctct 2530631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 3 - 50
Target Start/End: Original strand, 23896741 - 23896789
Alignment:
Q  3 atccgtacatgcagatggtgtatgcatgtgagttattttt-tcccttgt 50  Q
    |||| ||||||||| |||| |||||||||||||||||||| ||||||||    
T  23896741 atccatacatgcagttggtttatgcatgtgagttatttttctcccttgt 23896789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University