View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14984_low_18 (Length: 264)

Name: NF14984_low_18
Description: NF14984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14984_low_18
NF14984_low_18
[»] chr4 (1 HSPs)
chr4 (74-246)||(55477273-55477445)


Alignment Details
Target: chr4 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 74 - 246
Target Start/End: Original strand, 55477273 - 55477445
Alignment:
Q  74 catcgcttggatgttgtggtggtagtgatggttaaaccatcggttatggcaggggatgagttgggttcttgaacagggtcgtgtttgttttgggtggaaa 173  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  55477273 catcgcttggatgttgtggtggtagtgatggttaaaccatcggttatgggaggggatgagttgggttctggaacagggtcgtgtttgttttgggtggaaa 55477372  T
Q  174 ggaggtgaaggggaaggatgacgccgttaaggaagagttgatcggcgggaatgatgttgggttgtgggaaaga 246  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55477373 ggagatgaaggggaaggatgacgccgttaaggaagagttgatcggcgggaatgatgttgggttgtgggaaaga 55477445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University