View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14980_low_7 (Length: 219)

Name: NF14980_low_7
Description: NF14980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14980_low_7
NF14980_low_7
[»] chr3 (1 HSPs)
chr3 (38-205)||(31773076-31773243)


Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 38 - 205
Target Start/End: Complemental strand, 31773243 - 31773076
Alignment:
Q  38 acacgtgataatatttttcattgccaaaatcacattgtaaaattcagtttgaataatgaaatagaatttctttctatgttttgcagagcatctctttcct 137  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  31773243 acacgtgataatatttttcattgccaaaatcacattgtaaaattcagtttgaataatgaaatagaatttctttctatgttttgcagagcatctctttcct 31773144  T
Q  138 taataattttcattgccaaaatcacttttcacataaaggttataatatttgactttcaacttcttcat 205  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  31773143 taataattttcattgccaaaatcacttttcacataaaggtaataatatttgactttcaacttcttcat 31773076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University