View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1497_high_32 (Length: 236)

Name: NF1497_high_32
Description: NF1497
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1497_high_32
NF1497_high_32
[»] chr2 (1 HSPs)
chr2 (39-207)||(35363793-35363964)


Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 39 - 207
Target Start/End: Complemental strand, 35363964 - 35363793
Alignment:
Q  39 cttttctgaaaggtttattcaaattaagttatttactgnnnnnnnn-attacattcctaatttttcctatcaataatat--ctctattaacaaaaattta 135  Q
    ||||||||||| | ||||||||||||||||||||||||         |||||||||||||||||| |||||||||||||  ||||||||||||||||| |    
T  35363964 cttttctgaaaaggttattcaaattaagttatttactgtttttttttattacattcctaattttttctatcaataatatatctctattaacaaaaattaa 35363865  T
Q  136 acatcaaataatatcaaaatcgaatcaattttaaatgtaaaatagatagattggtgaaaaaattggtatata 207  Q
    || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  35363864 acgtcaaataatatcaaaatcgaatcaattttatatgtaaaatagatagattggtgaaaaaattggtatata 35363793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University