View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14979_high_28 (Length: 226)

Name: NF14979_high_28
Description: NF14979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14979_high_28
NF14979_high_28
[»] chr3 (2 HSPs)
chr3 (16-143)||(30885081-30885206)
chr3 (142-208)||(30885518-30885584)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 16 - 143
Target Start/End: Original strand, 30885081 - 30885206
Alignment:
Q  16 atgaacacataaataatctgtttgcttttgtttgtgaagcagtcagttgaaactgggtatatatattataaaaataattgtttgtggtagagtaaaatag 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||||||||||||||||||||||||||||||||    
T  30885081 atgaacacataaataatctgtttgcttttgtttgtgaagcagtcagttgaaactgggtgtata--ttataaaaataattgtttgtggtagagtaaaatag 30885178  T
Q  116 ggtgagttgtctctatcaaaataaacgg 143  Q
    ||||||||||||||||||||||||||||    
T  30885179 ggtgagttgtctctatcaaaataaacgg 30885206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 142 - 208
Target Start/End: Original strand, 30885518 - 30885584
Alignment:
Q  142 gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctat 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30885518 gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctat 30885584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University