View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14977_low_26 (Length: 247)

Name: NF14977_low_26
Description: NF14977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14977_low_26
NF14977_low_26
[»] chr4 (2 HSPs)
chr4 (7-53)||(46308964-46309010)
chr4 (47-136)||(46014809-46014901)


Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 7 - 53
Target Start/End: Original strand, 46308964 - 46309010
Alignment:
Q  7 tgatgtgagtgaatatcggcaactctagagtcaagaagtatatataa 53  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||    
T  46308964 tgatgtgggtgaatatcggcaactctagagtcaagaagtatatataa 46309010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 47 - 136
Target Start/End: Complemental strand, 46014901 - 46014809
Alignment:
Q  47 tatataaattttacaaaattggttacccggtcaaacctaattcgggttacaag----ctttggcccatgtgttttatttcatttaaataaataa 136  Q
    |||| |||||||||||||| |||||||| |||||||| |||||||| | ||||     |||||||||||| |||||||||| ||||||||||||    
T  46014901 tatagaaattttacaaaatcggttacccagtcaaacccaattcgggatgcaagttttttttggcccatgt-ttttatttcacttaaataaataa 46014809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University