View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14977_high_26 (Length: 211)

Name: NF14977_high_26
Description: NF14977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14977_high_26
NF14977_high_26
[»] chr3 (1 HSPs)
chr3 (13-194)||(41787416-41787596)


Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 41787416 - 41787596
Alignment:
Q  13 aagaatatatgtagggaaacgattgtaccctttaagggtatgcatgcacccattatttgcaaacctaatgtgcaggcaactaccgttaactctgtcttca 112  Q
    ||||| ||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||    
T  41787416 aagaacatatgtagggaaacgattgtaccctttaaaggtatgcatgcacccatt-ttcgcaaacctaatgtgcaggcaactaccgttaactctgtcttca 41787514  T
Q  113 tttttcatccttttttatgtgaaaatccaatggatttagcaatgtgaacaaaactatgattgcaattaacaattatccagaa 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41787515 tttttcatccttttttatgtgaaaatccaatggatttagcaatgtgaacaaaactatgattgcaattaacaattatccagaa 41787596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University