View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14974_low_7 (Length: 237)

Name: NF14974_low_7
Description: NF14974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14974_low_7
NF14974_low_7
[»] chr4 (2 HSPs)
chr4 (76-127)||(35281620-35281671)
chr4 (1-56)||(35276644-35276701)


Alignment Details
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 76 - 127
Target Start/End: Complemental strand, 35281671 - 35281620
Alignment:
Q  76 ttgctaccataatttgtttgtgaagttattagataacgtactctgaatagtg 127  Q
    |||||||||||||||||||||||||||||||||||| ||||||||| |||||    
T  35281671 ttgctaccataatttgtttgtgaagttattagataaggtactctgagtagtg 35281620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 35276701 - 35276644
Alignment:
Q  1 tataagacttgtggctttttcacacacacgtctcttttcaca--cagagatgattgag 56  Q
    ||||||||||||||||||||||||||||||||| ||||||||  ||||||||||||||    
T  35276701 tataagacttgtggctttttcacacacacgtcttttttcacacgcagagatgattgag 35276644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University