View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14969_low_40 (Length: 265)

Name: NF14969_low_40
Description: NF14969
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14969_low_40
NF14969_low_40
[»] chr7 (1 HSPs)
chr7 (16-250)||(30644740-30644974)


Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 30644974 - 30644740
Alignment:
Q  16 attgggtctgtgtcgaagttgaatgtgtattggttacactgtttgcttgctgctgatggatttgctatgttgtcattgtagactagggaggttaaattgt 115  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30644974 attgggtctgtgttgaagttgaatgtgtattggttacactgtttgcttgctgctgatggatttgctatgttgtcattgtagactagggaggttaaattgt 30644875  T
Q  116 tgccgaaatctgttcgaggagagcttgttattcgacgcacttgtcggaaaaagatccacgacaggatcatggctgtatctggtatggattacattgcttt 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30644874 tgccgaaatctgttcgaggagagcttgttattcgacgcacttgtcggaaaaagatccacgacaggatcatggctgtatctggtatggattacattgcttt 30644775  T
Q  216 ggctgactatggtgctttgaatgttgttagttgat 250  Q
    |||||||||||||||||||||||||||||||||||    
T  30644774 ggctgactatggtgctttgaatgttgttagttgat 30644740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University