View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14967_low_25 (Length: 240)

Name: NF14967_low_25
Description: NF14967
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14967_low_25
NF14967_low_25
[»] chr7 (2 HSPs)
chr7 (74-223)||(22274659-22274804)
chr7 (1-42)||(22274802-22274843)


Alignment Details
Target: chr7 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 74 - 223
Target Start/End: Complemental strand, 22274804 - 22274659
Alignment:
Q  74 tatattttaccaattatgtctgcattttattcttatagtggacatgatgatatgtactgtggcgcatctttatgaagcctttaaattaattgaaagatgt 173  Q
    |||||||||||||||||||| ||||||| |||||||||||||||||||   ||||| |||||||||||||||||||||||||||||| ||||||||||||    
T  22274804 tatattttaccaattatgtc-gcattttgttcttatagtggacatgat---atgtattgtggcgcatctttatgaagcctttaaattcattgaaagatgt 22274709  T
Q  174 cataaaacatcgtgacaatgcatgagaacatagataaatcattacaaaat 223  Q
    |||||||| | ||  ||||||||||||||||||| |||||||||||||||    
T  22274708 cataaaacttggtatcaatgcatgagaacatagacaaatcattacaaaat 22274659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 22274843 - 22274802
Alignment:
Q  1 tttgctgcatgtagtatactagcagatcgagaaatggagtat 42  Q
    ||||||||||||||||| ||||||||||||||||||||||||    
T  22274843 tttgctgcatgtagtatgctagcagatcgagaaatggagtat 22274802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University