View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14965_low_27 (Length: 264)

Name: NF14965_low_27
Description: NF14965
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14965_low_27
NF14965_low_27
[»] chr7 (2 HSPs)
chr7 (1-156)||(9122177-9122333)
chr7 (85-199)||(5219660-5219775)
[»] chr2 (1 HSPs)
chr2 (17-198)||(12545662-12545844)
[»] chr4 (2 HSPs)
chr4 (20-245)||(13956127-13956351)
chr4 (3-126)||(2487734-2487858)
[»] chr8 (1 HSPs)
chr8 (85-186)||(30869162-30869264)
[»] chr3 (1 HSPs)
chr3 (2-46)||(7809117-7809161)


Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 156
Target Start/End: Complemental strand, 9122333 - 9122177
Alignment:
Q  1 tgggaggctctgtggaaagatattattggagcgagatatgcgaaaaggtctatgtgggatcatcgcggggggagggcgataggtttaagaggtgtctc-a 99  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |    
T  9122333 tgggaggctctgtggaaagatattattggagcgagatatgcaaaaaggtctatgtgggatcatcgcggggggagggtgataggtttaagaggtgtctcaa 9122234  T
Q  100 actggtggaaaaaggtctccttattggaaacaagccagcctgagtctactgattggt 156  Q
    |||||||||||||| | ||||||||||||||||| ||||||||||||||| ||||||    
T  9122233 actggtggaaaaagatgtccttattggaaacaagtcagcctgagtctactaattggt 9122177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 85 - 199
Target Start/End: Original strand, 5219660 - 5219775
Alignment:
Q  85 ttaagaggtgtctcaa-ctggtggaaaaaggtctccttattggaaacaagccagcctgagtctactgattggttctctaacaatatcctcacgaaggtta 183  Q
    |||||||||||||||| || ||||||| || |||||||||||| | | ||  |||||||||||||| ||||||||||| | | |||||||| ||||||||    
T  5219660 ttaagaggtgtctcaaactagtggaaagagatctccttattgggatcgagttagcctgagtctactaattggttctctgaaagtatcctcaagaaggtta 5219759  T
Q  184 gagattgtcgatctac 199  Q
     ||||||| |||||||    
T  5219760 tagattgttgatctac 5219775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 12545844 - 12545662
Alignment:
Q  17 aagatattattggagcgagatatgcgaaaaggtctatgtgggatcatcgcggggggagggcgataggtttaagaggtgtctcaa-ctggtggaaaaaggt 115  Q
    ||||||||||||||| |||||||| |||| ||||||||||| |||||||  |||||  |||||| ||||||||| || ||| || ||||||||||  | |    
T  12545844 aagatattattggagtgagatatgtgaaagggtctatgtggaatcatcgtagggggcaggcgatgggtttaagatgtatctgaaactggtggaaagtgat 12545745  T
Q  116 ctccttattggaaacaagccagcctgagtctactgattggttctctaacaatatcctcacgaaggttagagattgtcgatcta 198  Q
    |||||||||| ||||||| || |||||| ||||||||||||| ||| | | ||| |||| ||||||||||||| |||||||||    
T  12545744 ctccttattgaaaacaagtcaacctgagcctactgattggttatctgatagtatgctcaggaaggttagagatggtcgatcta 12545662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 245
Target Start/End: Original strand, 13956127 - 13956351
Alignment:
Q  20 atattattggagcgagatatgcgaaaaggtctatgtgggatcatcgcggggggagggcgataggtttaagaggtgtctcaactggtggaaaaaggtctcc 119  Q
    ||||||||||||| ||||||  |||| ||  |||||| |||||||  ||||||    || | |||||||||||||||  |||||||| ||  || |||||    
T  13956127 atattattggagcaagatatttgaaagggcttatgtgagatcatcatggggggcacacggtgggtttaagaggtgtca-aactggtgcaaggagatctcc 13956225  T
Q  120 ttattggaaacaagccagcctgagtctactgattggttctctaacaatatcctcacgaaggttagagattgtcgatctacgannnnnnnaaaaggtccct 219  Q
    ||||||| |||| | ||| || |||||| ||||||||||||| | | ||| ||||  || ||||||||| |||||||||| |       ||||| |||||    
T  13956226 ttattgggaacatgtcagtctcagtctattgattggttctctgatagtatactcaaaaatgttagagatggtcgatctacaaatttactaaaagatccct 13956325  T
Q  220 agttgggtgttattcctttgagaatt 245  Q
     |||||| | ||||||||||||||||    
T  13956326 ggttgggagctattcctttgagaatt 13956351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 3 - 126
Target Start/End: Original strand, 2487734 - 2487858
Alignment:
Q  3 ggaggctctgtggaaagatattattggagcgagatatgcgaaaaggtctatgtgggatcatcgcggggggagggcgataggtttaagaggtgtctc-aac 101  Q
    ||||||| |||||||||||||||| ||||| ||||||  |||| |||||   || |||||| | |||||| |||||   | ||||||||||||||| |||    
T  2487734 ggaggctttgtggaaagatattataggagccagatatctgaaagggtctcaatgtgatcattgtggggggcgggcgggggttttaagaggtgtctcaaac 2487833  T
Q  102 tggtggaaaaaggtctccttattgg 126  Q
    ||||||||  || ||||||||||||    
T  2487834 tggtggaatgagatctccttattgg 2487858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 85 - 186
Target Start/End: Original strand, 30869162 - 30869264
Alignment:
Q  85 ttaagaggtgtctcaa-ctggtggaaaaaggtctccttattggaaacaagccagcctgagtctactgattggttctctaacaatatcctcacgaaggtta 183  Q
    ||||||| |||||||| |||||||||| || | |||||||||| | |||| || |||| || |||||||||||||||||| | |||||||| ||| ||||    
T  30869162 ttaagagatgtctcaaactggtggaaagagatatccttattgggatcaagtcaacctgggtttactgattggttctctaaaagtatcctcatgaatgtta 30869261  T
Q  184 gag 186  Q
    |||    
T  30869262 gag 30869264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 46
Target Start/End: Complemental strand, 7809161 - 7809117
Alignment:
Q  2 gggaggctctgtggaaagatattattggagcgagatatgcgaaaa 46  Q
    |||||| | ||| ||||||||||||||||||||||||||| ||||    
T  7809161 gggaggttttgttgaaagatattattggagcgagatatgcaaaaa 7809117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University