View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1495_low_13 (Length: 215)

Name: NF1495_low_13
Description: NF1495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1495_low_13
NF1495_low_13
[»] chr8 (2 HSPs)
chr8 (90-199)||(29715500-29715609)
chr8 (17-80)||(29715704-29715767)


Alignment Details
Target: chr8 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 90 - 199
Target Start/End: Complemental strand, 29715609 - 29715500
Alignment:
Q  90 atttgtgattagtattcacagttttcatccctttgttgtagaacattttacacgacggttatgatggtggtgatgataaccctaaggatcgagatgctcc 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29715609 atttgtgattagtattcacagttttcatccctttgttgtagaacattttacacgacggttatgatggtggtgatgataaccctaaggatcgagatgctcc 29715510  T
Q  190 tctagataat 199  Q
    ||||| ||||    
T  29715509 tctaggtaat 29715500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 17 - 80
Target Start/End: Complemental strand, 29715767 - 29715704
Alignment:
Q  17 atacttttcatctttaaaatgaatcaaaaatttaattttaaataagggcaatttgaatattata 80  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29715767 atacttttaatctttaaaatgaatcaaaaatttaattttaaataagggcaatttgaatattata 29715704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University