View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1495_low_11 (Length: 242)

Name: NF1495_low_11
Description: NF1495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1495_low_11
NF1495_low_11
[»] chr8 (1 HSPs)
chr8 (39-184)||(34321460-34321605)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 39 - 184
Target Start/End: Original strand, 34321460 - 34321605
Alignment:
Q  39 ctcttttgtacttgtaatctgttcattttagttaatttactattgtttactttctctaaatctggctgttatatctacattaagggtattgcatttgtgg 138  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  34321460 ctcttttgcacttgtaatctgttcattttagttaatttactattgtttactttctctaaatctggctgttatatctacattaagggtattgcaattgtgg 34321559  T
Q  139 attcagtaatgattagtgtttatcttgtgaatgaaaaaattgcaat 184  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  34321560 attcagtaatgattagtgtttatcttgtgaatgaaaaaattgcaat 34321605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University