View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14955_low_7 (Length: 210)

Name: NF14955_low_7
Description: NF14955
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14955_low_7
NF14955_low_7
[»] chr3 (2 HSPs)
chr3 (17-202)||(39306754-39306940)
chr3 (28-152)||(39306546-39306673)


Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 17 - 202
Target Start/End: Original strand, 39306754 - 39306940
Alignment:
Q  17 aagaaatgcaactagagatattgtttatagtat-gtgggtaaggcaaaaatcacacttcttgatcaggcttacctaggagagatatcctacttatctaaa 115  Q
    ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39306754 aagaaatgcaactagagatattgtttatagtatcgtgagtaaggcaaaaatcacacttcttgatcaggcttacctaggagagatatcctacttatctaaa 39306853  T
Q  116 atgaggagtgcaattgagaatacttcttacaatatgatgttagatnnnnnnnncagaaattgactataactttgatatttgatgatg 202  Q
    ||||||||||||||||||||||||||||||||||| |||||||||        |||||||||||| |||||||||||||||||||||    
T  39306854 atgaggagtgcaattgagaatacttcttacaatataatgttagataaaaaacacagaaattgactctaactttgatatttgatgatg 39306940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 28 - 152
Target Start/End: Original strand, 39306546 - 39306673
Alignment:
Q  28 ctagagatattgtttatagtatg---tgggtaaggcaaaaatcacacttcttgatcaggcttacctaggagagatatcctacttatctaaaatgaggagt 124  Q
    ||||||||||||||||||||||    || | | | ||| |||||||||||||| | |||||||| ||| | |||||||||||||| ||||| ||||||||    
T  39306546 ctagagatattgtttatagtatcgtttgtgcatgacaataatcacacttcttgcttaggcttacttagtaaagatatcctacttaactaaagtgaggagt 39306645  T
Q  125 gcaattgagaatacttcttacaatatga 152  Q
    ||||||||||| |||||  |||||||||    
T  39306646 gcaattgagaacacttcgcacaatatga 39306673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University