View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14950_low_6 (Length: 207)

Name: NF14950_low_6
Description: NF14950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14950_low_6
NF14950_low_6
[»] scaffold0005 (1 HSPs)
scaffold0005 (17-131)||(228689-228803)
[»] chr4 (1 HSPs)
chr4 (17-131)||(14588575-14588689)


Alignment Details
Target: scaffold0005 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 17 - 131
Target Start/End: Complemental strand, 228803 - 228689
Alignment:
Q  17 cactatgcatatgctttaactatcttgaccaggaaaagatacgagttgctctttatgtacaaaaagcagcattgcattttataaacggtaatctacattc 116  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  228803 cactatgcatatgctttaactatcttgaccaggagaagatacgagttgctctttatgtacaaaaagcagcattgcattttataaacggtaatctacattc 228704  T
Q  117 aatagctttcattca 131  Q
    |||||||||||||||    
T  228703 aatagctttcattca 228689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 17 - 131
Target Start/End: Original strand, 14588575 - 14588689
Alignment:
Q  17 cactatgcatatgctttaactatcttgaccaggaaaagatacgagttgctctttatgtacaaaaagcagcattgcattttataaacggtaatctacattc 116  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14588575 cactatgcatatgctttaactatcttgaccaggagaagatacgagttgctctttatgtacaaaaagcagcattgcattttataaacggtaatctacattc 14588674  T
Q  117 aatagctttcattca 131  Q
    |||||||||||||||    
T  14588675 aatagctttcattca 14588689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University