View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14944_high_35 (Length: 207)

Name: NF14944_high_35
Description: NF14944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14944_high_35
NF14944_high_35
[»] chr8 (2 HSPs)
chr8 (100-193)||(34723163-34723256)
chr8 (1-35)||(34723321-34723355)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 4e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 100 - 193
Target Start/End: Complemental strand, 34723256 - 34723163
Alignment:
Q  100 ataaagtaataataaatgaacaagtttaaccgttaagaatctcactgtactctactatcaaataaccattacaactggaagtgctgtgtttggt 193  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34723256 ataaagtaataataaatgaacaagtttaaccgttaagaatctcactgtactctactatcaaataaccattacaactggaagtgctgtgtttggt 34723163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 34723355 - 34723321
Alignment:
Q  1 ccattgcctcactctacacactttcattccagtac 35  Q
    |||||||||||||||||||||||||||||||||||    
T  34723355 ccattgcctcactctacacactttcattccagtac 34723321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University