View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14943_high_25 (Length: 243)

Name: NF14943_high_25
Description: NF14943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14943_high_25
NF14943_high_25
[»] chr2 (1 HSPs)
chr2 (1-225)||(24034824-24035048)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 24034824 - 24035048
Alignment:
Q  1 tgttttggatgggtgaaacgtcggtgtcgtcggtgtatgagtagagatgttgaagttggaggggttggggctaaggttatggtttgtgatgaagaagtgg 100  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  24034824 tgttttggatgggtgaaacgtcggtgtcgtcgatgtatgagtagagatgttgaagttggaggcgttggggctaaggttatggtttgtgatgaagaagtgg 24034923  T
Q  101 agaatgattgcaaggtcaaagatggtgatgttcaagtttagnnnnnnnnnnnnataggtagatgtttgtataagagatcgatcgaatattggacctctta 200  Q
    |||||||||||||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||||||||| |||||    
T  24034924 agaatgattgcaaggtcaaagatggtgatgttcaagtttagtttttctttttcataggtagatgtttgtataagagatcgatcgaatattggacttctta 24035023  T
Q  201 tatataatttcttcaatgtctaaat 225  Q
    |||||||||||||||||||||||||    
T  24035024 tatataatttcttcaatgtctaaat 24035048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University