View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14942_low_9 (Length: 320)

Name: NF14942_low_9
Description: NF14942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14942_low_9
NF14942_low_9
[»] chr6 (1 HSPs)
chr6 (66-314)||(12295508-12295756)


Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 66 - 314
Target Start/End: Original strand, 12295508 - 12295756
Alignment:
Q  66 tatatacactgtttactatcgtttaagaatcattgtttactaaaattaggccatttttagaggttttaagacggcttccgacttgaaggttaattttttg 165  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  12295508 tatatacactgtttactatcgtttaagaatcattgtttactaaaattaggccgtttttagaggttttaagacggcttccgacttgaaggttaattttttg 12295607  T
Q  166 aaaagtttttagttgcagtaaatgttgatcaaaggtttttggaaatagcgtgtgatttcttaaattgtgctcaaagagttatttcgtttaattacttggg 265  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  12295608 aaaagtttttagttgcagtaaatgttgatcaaaggtttttggaaatagcgtgtgatttcttaaattgtgctcaaagagttatttcgtttaattacttggg 12295707  T
Q  266 gttaccggggtaaatccgaggaagatctctacgtgggagcctatgttac 314  Q
    | |||||||||||||||||||||||||||||||||||||||||||||||    
T  12295708 gctaccggggtaaatccgaggaagatctctacgtgggagcctatgttac 12295756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University