View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14940_high_21 (Length: 250)

Name: NF14940_high_21
Description: NF14940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14940_high_21
NF14940_high_21
[»] chr4 (1 HSPs)
chr4 (11-206)||(4247302-4247492)


Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 11 - 206
Target Start/End: Complemental strand, 4247492 - 4247302
Alignment:
Q  11 cacagatgctcgaccaaaaactggcattaaggatttgcatttcatcaacaaatataatatgcatagaaaatgaacatgataaagtgattggacaaattct 110  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||| |||||    
T  4247492 cacagatgctcgaccaaaaactggcattaaggatttgcatttcatcaacaaatat-----gcatagaaaatgaacatgataaagtgattggacagattct 4247398  T
Q  111 ccattggagacaaccccaaacaaaatgttatgtacaatatgcagctaacaagactatcggtgatttgatatcaagctcaagctaaggaccttcaaa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  4247397 ccattggagacaaccccaaacaaaatgttatgtacaatatgcagctaacaagactattggtgatttgatatcaagctcaagctaaggaccttcaaa 4247302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University