View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14939_low_10 (Length: 304)

Name: NF14939_low_10
Description: NF14939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14939_low_10
NF14939_low_10
[»] chr5 (2 HSPs)
chr5 (107-290)||(38127588-38127771)
chr5 (26-112)||(38127995-38128081)
[»] chr7 (1 HSPs)
chr7 (131-184)||(43970089-43970142)


Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 107 - 290
Target Start/End: Complemental strand, 38127771 - 38127588
Alignment:
Q  107 aagtcaatagggtcacacgtagccttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccattatttcttgatcattttgatca 206  Q
    ||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  38127771 aagtcaataaggtcacatgtagccttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccgttatttcttgatcattttgatca 38127672  T
Q  207 cagatgaaattaattcattttactttctctnnnnnnnnnnnngtaatactctaacaaaacataaataaacaatcacattcattc 290  Q
    ||||||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||| ||||||||    
T  38127671 cagatgaaattaattcattttactttctctaaaaaagaaaaagtaatactctaacaaaacataaataaacaatcatattcattc 38127588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 26 - 112
Target Start/End: Complemental strand, 38128081 - 38127995
Alignment:
Q  26 acctcaacataccacagaacacagatggttgaaaccccctgaagtaatgtcgattcgcccacacaaattggtcatcaagtaaagtca 112  Q
    ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38128081 acctcaacataccgcagaacacagatggttgaaaacccctgaagtaatgtcgattcgcccacacaaattggtcatcaagtaaagtca 38127995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 131 - 184
Target Start/End: Original strand, 43970089 - 43970142
Alignment:
Q  131 ttgctagagcctccttatcctatactagtccccatgatttctatgatgtaccat 184  Q
    |||||||||| ||||||||| || |||| ||||||  |||||||||||||||||    
T  43970089 ttgctagagcgtccttatccaatcctagcccccatattttctatgatgtaccat 43970142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University