View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14931_low_5 (Length: 228)

Name: NF14931_low_5
Description: NF14931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14931_low_5
NF14931_low_5
[»] chr1 (1 HSPs)
chr1 (18-222)||(10132812-10133016)


Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 222
Target Start/End: Complemental strand, 10133016 - 10132812
Alignment:
Q  18 atgctttcatgtgtttatatgcatgactctggaacttgcatatttttcaatactttaagaataggttaggaatttcacatgagannnnnnnggttaaaca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||    
T  10133016 atgctttcatgtgtttatatgcatgactctggaacttgcatatttttcaatactttaagaataggttaggaatttcacatgagatttttttggttaaaca 10132917  T
Q  118 tgttattactttattggggtaaagtattactgtctgtttttgccacctttagtagttattatgctcggaactatgactgaccatctttagtggagtctct 217  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||    
T  10132916 tgttattactttattggggtaaagtattacagtctgtttttgccacctttagtagttactatgctcagaactatgactgaccatctttagtggaatctct 10132817  T
Q  218 gctcc 222  Q
    |||||    
T  10132816 gctcc 10132812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University