View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1492_low_74 (Length: 204)

Name: NF1492_low_74
Description: NF1492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1492_low_74
NF1492_low_74
[»] chr7 (1 HSPs)
chr7 (16-188)||(22956783-22956955)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 16 - 188
Target Start/End: Complemental strand, 22956955 - 22956783
Alignment:
Q  16 aatataaaaatggttaaggaaaaataatagaatgatttttaatacttaattaattaagtaggtagttcacctaaccacgcatatgcggggaatggatttg 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22956955 aatataaaaatggttaaggaaaaataatagaatgatttttaatacttaattaattaagtaggtagttcacctaaccacgcatatgcggggaatggatttg 22956856  T
Q  116 ctcaacaatacgtcaataaaacttgcaaacctttaatgcgtaagtaaataaaacttgatttttgtgtgaaaaa 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  22956855 ctcaacaatacgtcaataaaacttgcaaacctttaatgcgtaagtaaataaaacttgatttttgtttgaaaaa 22956783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University